Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@Evo2 MCP Serverscore this DNA sequence: ATGCGATACGTTAGCTAGCTAG"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
evo2-mcp

The evo2-mcp server exposes Evo 2 as a Model Context Protocol (MCP) server, providing tools for genomic sequence analysis. Any MCP-compatible client can use these tools to score, embed, and generate DNA sequences.
Features
Sequence Scoring: Compute log probabilities for DNA sequences
Sequence Embedding: Extract learned representations from intermediate model layers
Sequence Generation: Generate novel DNA sequences with controlled sampling
Variant Effect Prediction: Score SNP mutations for variant prioritization
Multiple Model Checkpoints: Support for 7B, 40B, and 1B parameter models
Getting Started
Prerequisites: Python 3.12
Install Evo2 dependencies: See for details.
conda install -c nvidia cuda-nvcc cuda-cudart-dev conda install -c conda-forge transformer-engine-torch=2.3.0 pip install flash-attn==2.8.0.post2 --no-build-isolation pip install evo2Install evo2-mcp:
pip install evo2-mcpActivate MCP Server: Add the following to your
mcp.jsonconfiguration:{ "mcpServers": { "evo2-mcp": { "command": "python", "args": ["-m", "evo2_mcp.main"] } } }
For detailed installation instructions, see the .
Usage
Once installed, the server can be accessed by any MCP-compatible client. For available tools and usage examples, see the .
Available Tools
score_sequence- Evaluate DNA sequence likelihoodembed_sequence- Extract feature representationsgenerate_sequence- Generate novel DNA sequencesscore_snp- Predict variant effectsget_embedding_layers- List available embedding layerslist_available_checkpoints- Show supported model checkpoints
See the for detailed API reference and examples.
Documentation
- Detailed installation instructions
- Complete API documentation and usage examples
- Contributing and testing information
- Version history and updates
You can also find this project on BioContextAI, the community hub for biomedical MCP servers.
Citation
If you use evo2-mcp in your research, please cite:
@software{evo2_mcp,
author = {Kreuer, Jules},
title = {evo2-mcp: MCP server for Evo 2 genomic sequence operations},
year = {2025},
url = {https://github.com/not-a-feature/evo2-mcp},
version = {0.2.2}
}For the underlying Evo 2 model, please also cite the original Evo 2 publication.
License and Attribution
The banner image in this repository is a modified version of the original Evo 2 banner from the Evo 2 project, which is released under the Apache 2.0 License. It was modified using Google Gemini "Nanobana" and GIMP.