Evo2 MCP Server
Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@Evo2 MCP Serverscore this DNA sequence: ATGCGATACGTTAGCTAGCTAG"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
evo2-mcp

The evo2-mcp server exposes Evo 2 as a Model Context Protocol (MCP) server, providing tools for genomic sequence analysis. Any MCP-compatible client can use these tools to score, embed, and generate DNA sequences.
Features
Sequence Scoring: Compute log probabilities for DNA sequences
Sequence Embedding: Extract learned representations from intermediate model layers
Sequence Generation: Generate novel DNA sequences with controlled sampling
Variant Effect Prediction: Score SNP mutations for variant prioritization
Multiple Model Checkpoints: Support for 7B, 40B, and 1B parameter models
Related MCP server: AlphaGenome MCP Server
Getting Started
Prerequisites: Python 3.12
Install Evo2 dependencies: See Installation Guide for details.
conda install -c nvidia cuda-nvcc cuda-cudart-dev conda install -c conda-forge transformer-engine-torch=2.3.0 pip install flash-attn==2.8.0.post2 --no-build-isolation pip install evo2Install evo2-mcp:
pip install evo2-mcpActivate MCP Server: Add the following to your
mcp.jsonconfiguration:{ "mcpServers": { "evo2-mcp": { "command": "python", "args": ["-m", "evo2_mcp.main"] } } }
For detailed installation instructions, see the Installation Guide.
Usage
Once installed, the server can be accessed by any MCP-compatible client. For available tools and usage examples, see the Tools Documentation.
Available Tools
score_sequence- Evaluate DNA sequence likelihoodembed_sequence- Extract feature representationsgenerate_sequence- Generate novel DNA sequencesscore_snp- Predict variant effectsget_embedding_layers- List available embedding layerslist_available_checkpoints- Show supported model checkpoints
See the Tools Documentation for detailed API reference and examples.
Documentation
Installation Guide - Detailed installation instructions
Tools Reference - Complete API documentation and usage examples
Development Guide - Contributing and testing information
Changelog - Version history and updates
You can also find this project on BioContextAI, the community hub for biomedical MCP servers.
Citation
If you use evo2-mcp in your research, please cite:
@software{evo2_mcp,
author = {Kreuer, Jules},
title = {evo2-mcp: MCP server for Evo 2 genomic sequence operations},
year = {2025},
url = {https://github.com/not-a-feature/evo2-mcp},
version = {0.2.3}
}For the underlying Evo 2 model, please also cite the original Evo 2 publication.
License and Attribution
The banner image in this repository is a modified version of the original Evo 2 banner from the Evo 2 project, which is released under the Apache 2.0 License. It was modified using Google Gemini "Nanobana" and GIMP.
Maintenance
Resources
Unclaimed servers have limited discoverability.
Looking for Admin?
If you are the server author, to access and configure the admin panel.
Related MCP Servers
- AlicenseNot gradedqualityDmaintenanceEnables molecular generation, optimization, and analysis through NVIDIA MolMIM API. Supports generating drug-like molecules with desired properties, extracting molecular embeddings, and exploring chemical space around seed molecules.MIT
- AlicenseBqualityDmaintenanceEnables AI-powered genomic variant analysis including variant impact prediction, regulatory element discovery, and batch variant scoring. Currently operates in mock mode as a proof-of-concept awaiting the public release of Google DeepMind's AlphaGenome API.20142MIT

bio-mcp-evo2official
AlicenseNot gradedqualityDmaintenanceAn MCP server that enables AI assistants to generate, score, and analyze DNA sequences using the evo2 genomic foundation model. It supports multiple execution modes including local GPU, SLURM clusters, and the Nvidia NIM cloud API for tasks like variant effect prediction and sequence embedding.MIT- FlicenseAqualityFmaintenanceProvides interpretable variant effect predictions for 4.2 million ClinVar variants using the EVEE API. Enables searching, comparing, and analyzing genetic variants with AI-generated mechanistic interpretations and disruption profiles.617
Related MCP Connectors
Provision private AI model endpoints on dedicated GPUs (Llama, Qwen, Mistral). Pay per minute.
Run 100+ AI models — image, video, audio, 3D — through one API with pay-per-use billing.
Build, validate, and deploy multi-agent AI solutions from any AI environment.
Latest Blog Posts
- Who's Calling? MCP Hosts Are an Identity Blind Spot (And the Spec Knows It)By Om-Shree-0709 on .mcpAgent IdentityOAuth 2.1
- Your AI Chatbot Just Exposed Your CEO's Salary to an InternBy Om-Shree-0709 on .Agent IdentityMCP SecurityOAuth Delegation
- Why MCP Servers Need Execution Sandboxing (And Why Your Current Stack Isn't Enough)By Om-Shree-0709 on .Agentic AiPrompt InjectionWebAssembly
MCP directory API
We provide all the information about MCP servers via our MCP API.
curl -X GET 'https://glama.ai/api/mcp/v1/servers/not-a-feature/evo2-mcp'
If you have feedback or need assistance with the MCP directory API, please join our Discord server