Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@Evo2 MCP Serverscore this DNA sequence: ATGCGATACGTTAGCTAGCTAG"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
evo2-mcp

The evo2-mcp server exposes Evo 2 as a Model Context Protocol (MCP) server, providing tools for genomic sequence analysis. Any MCP-compatible client can use these tools to score, embed, and generate DNA sequences.
Features
Sequence Scoring: Compute log probabilities for DNA sequences
Sequence Embedding: Extract learned representations from intermediate model layers
Sequence Generation: Generate novel DNA sequences with controlled sampling
Variant Effect Prediction: Score SNP mutations for variant prioritization
Multiple Model Checkpoints: Support for 7B, 40B, and 1B parameter models
Getting Started
Prerequisites: Python 3.12
Install Evo2 dependencies: See for details.
conda install -c nvidia cuda-nvcc cuda-cudart-dev conda install -c conda-forge transformer-engine-torch=2.3.0 pip install flash-attn==2.8.0.post2 --no-build-isolation pip install evo2Install evo2-mcp:
pip install evo2-mcpActivate MCP Server: Add the following to your
mcp.jsonconfiguration:{ "mcpServers": { "evo2-mcp": { "command": "python", "args": ["-m", "evo2_mcp.main"] } } }
For detailed installation instructions, see the .
Usage
Once installed, the server can be accessed by any MCP-compatible client. For available tools and usage examples, see the .
Available Tools
score_sequence- Evaluate DNA sequence likelihoodembed_sequence- Extract feature representationsgenerate_sequence- Generate novel DNA sequencesscore_snp- Predict variant effectsget_embedding_layers- List available embedding layerslist_available_checkpoints- Show supported model checkpoints
See the for detailed API reference and examples.
Documentation
- Detailed installation instructions
- Complete API documentation and usage examples
- Contributing and testing information
- Version history and updates
You can also find this project on BioContextAI, the community hub for biomedical MCP servers.
Citation
If you use evo2-mcp in your research, please cite:
@software{evo2_mcp,
author = {Kreuer, Jules},
title = {evo2-mcp: MCP server for Evo 2 genomic sequence operations},
year = {2025},
url = {https://github.com/not-a-feature/evo2-mcp},
version = {0.2.2}
}For the underlying Evo 2 model, please also cite the original Evo 2 publication.
License and Attribution
The banner image in this repository is a modified version of the original Evo 2 banner from the Evo 2 project, which is released under the Apache 2.0 License. It was modified using Google Gemini "Nanobana" and GIMP.
This server cannot be installed
Resources
Unclaimed servers have limited discoverability.
Looking for Admin?
If you are the server author, to access and configure the admin panel.