biotools-mcp
biotools-mcp provides 11 scientifically verified bioinformatics and statistical tools, backed by BioPython and scipy, designed to prevent AI agents from hallucinating calculations. These tools are exposed via an MCP server (stdio or streamable HTTP) for programmatic access by AI agents.
Sequence Utilities:
seq_gc_content– Calculate GC content percentage (0–100) from DNA/RNA, excluding ambiguous bases.seq_reverse_complement– Compute reverse complement with full IUPAC ambiguity support.seq_translate– Translate nucleotide sequence to protein using any NCBI genetic code table.seq_orf_finder– Find ORFs in forward strand (frames 0–2) with configurable minimum length.seq_motif_scan– Scan for IUPAC motifs supporting bracket groups (e.g., ATG[AC]) and overlap control.seq_stats– Compute length, mononucleotide/dinucleotide composition, and GC skew.
Statistical Tests & Analysis:
stats_describe– Descriptive statistics: n, min, max, mean, median, variance, std dev, skewness, kurtosis.stats_t_test– Two-sample t-test (Student/Welch) with Cohen's d, one- or two-sided.stats_chi_square– Chi-square test of independence with optional Yates' correction.stats_mann_whitney– Mann-Whitney U test with exact/asymptotic p-value.stats_correlation– Pearson or Spearman correlation between two paired variables.
Data formats: Accepts sequences and numeric arrays; returns structured results suitable for analysis. Use cases include sequence analysis and statistical hypothesis testing in bioinformatics.
Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@biotools-mcpCalculate the GC content of the sequence ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
biotools-mcp
Verified bioinformatics tools for AI agents — sequence utilities + statistics, backed by BioPython/scipy, exposed as an MCP server, companion Skill, and Python package.
MIT · public · benchmarked.
Research agents hallucinate bioinformatics math. This project builds the missing layer: battle-tested scientific computation wrapped in a clean, agent-native surface.
What's inside
Sequence utilities — GC content, reverse complement, translation, ORF finding, motif scanning, sequence stats (BioPython-backed; ORF finder + motif-overlap are custom logic, checked against independent references).
Statistics — descriptive stats, t-test, chi-square, Mann–Whitney U, correlation (scipy-backed, reference-vector tested against published/R values).
MCP server — stdio + streamable HTTP, 11 action-oriented tools (
seq_gc_content,stats_t_test, …), pydantic v2 schemas with structured output.Companion Skill — agentskills.io spec: when to use which tool, input requirements, and what not to do.
Every tool is reference-vector tested against published values (GenBank records, R t.test
output, Mendel's 1866 pea counts, Anscombe's quartet) — never against the wrapper itself.
Related MCP server: protein-design-mcp
Install
Published on PyPI as biotools-mcp (requires Python 3.11+).
# Install as a standalone CLI (MCP server entry point)
uv tool install biotools-mcp
# Or run without installing
uvx biotools-mcp
# Or plain pip
pip install biotools-mcpAs a library:
uv add biotools-mcpfrom biotools_mcp.seq import gc_content
from biotools_mcp.stats import t_test
print(gc_content("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG").gc_percent) # 56.4103
print(t_test([1, 2, 3], [4, 5, 6]).statistic) # -3.6742MCP configuration
Point your agent at the server over stdio:
Claude Code (.mcp.json):
{
"mcpServers": {
"biotools-mcp": {
"command": "uvx",
"args": ["biotools-mcp"]
}
}
}Cursor — Settings → MCP → Add:
{
"mcpServers": {
"biotools-mcp": {
"command": "uvx",
"args": ["biotools-mcp"]
}
}
}Codex / Gemini CLI — same mcpServers block in the agent's MCP config file.
Streamable HTTP (for remote use):
uvx biotools-mcp --transport streamable-httpTools
Tool | Description |
| GC content as a percentage (ambiguous bases excluded) |
| Reverse complement (IUPAC-aware, DNA/RNA) |
| Translate to protein (NCBI tables, incl. mitochondrial) |
| Open reading frames, forward strand, frames 0–2 |
| IUPAC motif scanning with bracket groups + overlap policy |
| Length, mono/di composition, GC skew |
| Descriptive statistics (n, mean, median, var, skew, kurtosis) |
| Student/Welch two-sample t-test with Cohen's d |
| Chi-square test of independence (Yates optional) |
| Mann-Whitney U test (exact/asymptotic) |
| Pearson or Spearman correlation |
Benchmarks
Wedge subset of BioAgent Bench + BioTaskBench (sequence utilities + statistics) run against the tools and published in benchmarks/results.md. Every task in the subset runs — failures are published alongside passes.
Current: 15/15 passed (100%) — bioagent-bench subset 7/7, bioTaskBench subset 8/8. Pinned harness, see the results file for task-level detail.
uv run python benchmarks/run_bioagent_bench.py # 7/7
uv run python benchmarks/run_biotaskbench.py # 8/8
uv run python benchmarks/harness.py --suite all # combined 15/15Companion Skill
The skills/biotools-mcp skill (agentskills.io spec) teaches agents the tool inventory, when to use which tool, input requirements, and what not to do (never compute GC/translation/t-tests by hand). Load it into any skills-compatible agent.
Documented solutions
Past problems and the patterns they produced live in
docs/solutions — including the uvx grandchild-process leak in
subprocess tests, mcp SDK v2 tool-registration conventions, and the CI matrix Python-version
trap. Relevant when implementing or debugging in those areas.
Development
uv sync --extra dev
uv run pytest # reference-vector suite (skips slow packaging by default)
uv run python benchmarks/harness.py --suite all # regenerate benchmark results
uvx ruff check src tests benchmarksCI runs lint + tests on Python 3.11/3.12; a nightly workflow regenerates the benchmark table;
a tag-pushed v* triggers the PyPI publish workflow.
Contributing
See CONTRIBUTING.md — verification is non-circular (reference-vector fixtures from published values), degenerate inputs must fail loudly, and benchmark tasks are never dropped to keep numbers green. Changes are tracked in CHANGELOG.md.
License
MIT — see LICENSE.
Maintenance
Resources
Unclaimed servers have limited discoverability.
Looking for Admin?
If you are the server author, to access and configure the admin panel.
Related MCP Servers
- AlicenseNot gradedqualityCmaintenanceAn MCP server that enables scRNA-Seq analysis through natural language, providing tools for data preprocessing, clustering, and biological visualization. It supports both predefined function execution and a flexible code mode powered by a Jupyter backend for automated single-cell transcriptomics workflows.15BSD 3-Clause
- AlicenseNot gradedqualityCmaintenanceAn MCP server that gives LLM agents access to computational protein design tools.15Apache 2.0
- AlicenseNot gradedqualityCmaintenanceMCP-native scientific skills for reproducible computational biology and AI-driven drug-discovery workflows. It combines deterministic scientific tools with an MCP server to give AI agents real computational capabilities.Apache 2.0
- AlicenseNot gradedqualityBmaintenanceA statistical analysis MCP server offering 30 tools for descriptive statistics, hypothesis tests, regression, and time series, all returning Markdown reports with automatic interpretations to enable AI agents to perform comprehensive data analysis.MIT
Related MCP Connectors
Hosted MCP with 91 agent tools: X, domains, SEO, Maps, Trends, Search, YouTube, TikTok, and more.
OCR, transcription, file extraction, and image generation for AI agents via MCP.
MCP server for secureFlows: token-free URL builders and integration-linting tools for AI agents.
Latest Blog Posts
- Who's Calling? MCP Hosts Are an Identity Blind Spot (And the Spec Knows It)By Om-Shree-0709 on .mcpAgent IdentityOAuth 2.1
- Your AI Chatbot Just Exposed Your CEO's Salary to an InternBy Om-Shree-0709 on .Agent IdentityMCP SecurityOAuth Delegation
- Why MCP Servers Need Execution Sandboxing (And Why Your Current Stack Isn't Enough)By Om-Shree-0709 on .Agentic AiPrompt InjectionWebAssembly
MCP directory API
We provide all the information about MCP servers via our MCP API.
curl -X GET 'https://glama.ai/api/mcp/v1/servers/madhusudan-kulkarni/biotools-mcp'
If you have feedback or need assistance with the MCP directory API, please join our Discord server