BioPython MCP Server
# BioPython MCP Server
[](https://github.com/kmaneesh/biopython-mcp/actions/workflows/ci.yml)
[](https://codecov.io/gh/kmaneesh/biopython-mcp)
[](https://pypi.org/project/biopython-mcp/)
[](https://pypi.org/project/biopython-mcp/)
[](https://www.python.org/downloads/)
[](https://opensource.org/licenses/MIT)
[](https://github.com/psf/black)
A Model Context Protocol (MCP) server that provides comprehensive BioPython capabilities for biological sequence analysis, alignment, database access, and structural bioinformatics.
## Overview
BioPython MCP bridges the powerful BioPython library with MCP-enabled applications like Claude Desktop, allowing seamless integration of bioinformatics tools into AI-assisted workflows. This enables researchers, clinicians, and developers to perform complex biological analyses through natural language interfaces.
## Motivation
Bioinformatics workflows often require switching between multiple tools and writing custom scripts. BioPython MCP simplifies this by:
- **Unified Interface**: Access BioPython's capabilities through a standardized MCP protocol
- **AI Integration**: Combine computational biology with AI-powered analysis and interpretation
- **Workflow Automation**: Chain complex bioinformatics tasks through conversational interfaces
- **Accessibility**: Make advanced bioinformatics tools available to non-programmers
## Features
- **Sequence Operations**
- DNA/RNA translation and transcription
- Reverse complement calculation
- GC content analysis
- Motif finding and pattern matching
- **Sequence Alignment**
- Pairwise global and local alignment
- Multiple sequence alignment support
- Alignment scoring with substitution matrices
- **Database Access**
- GenBank sequence retrieval
- UniProt protein data access
- PubMed literature search
- NCBI database queries
- **Protein Structure Analysis**
- PDB structure fetching and parsing
- Structure statistics calculation
- Active site residue analysis
- **Phylogenetics**
- Phylogenetic tree construction (NJ, UPGMA)
- Distance matrix calculation
- Tree visualization
## Installation
### Requirements
- Python 3.10 or higher
- pip or [uv](https://docs.astral.sh/uv/) package manager
### Quick Install with uvx (Recommended)
The fastest way to run BioPython MCP without installation:
```bash
uvx biopython-mcp
```
Or run from source:
```bash
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uvx --from . biopython-mcp
```
### Install from PyPI
```bash
pip install biopython-mcp
```
### Install from Source with uv
```bash
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate # On Windows: .venv\Scripts\activate
uv pip install -e ".[dev]"
```
### Install from Source with pip
```bash
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
pip install -e ".[dev]"
```
### Development Installation
For contributing or development:
```bash
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate
uv pip install -e ".[dev]"
pre-commit install
```
## Quick Start
### Running the Server
Start the MCP server:
```bash
# With uvx (no installation needed)
uvx biopython-mcp
# Or if installed
biopython-mcp
```
### Configuration for Claude Desktop
Add to your Claude Desktop configuration file:
**macOS**: `~/Library/Application Support/Claude/claude_desktop_config.json`
**Windows**: `%APPDATA%\Claude\claude_desktop_config.json`
**Using uvx (recommended):**
```json
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
```
**Using installed package:**
```json
{
"mcpServers": {
"biopython": {
"command": "biopython-mcp",
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
```
**Using local development version:**
```json
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["--from", "/path/to/biopython-mcp", "biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
```
### Basic Usage Example
Once configured, you can use BioPython tools through Claude Desktop:
```
User: Translate the DNA sequence ATGGCCATTGTAATGGGCCGC to protein
Claude: [Uses translate_sequence tool]
Result: MAIVMGR (7 amino acids)
User: What's the GC content of this sequence?
Claude: [Uses calculate_gc_content tool]
Result: 57.14% GC content
```
## Available Tools
### Sequence Operations
| Tool | Description |
|------|-------------|
| `translate_sequence` | Translate DNA/RNA to protein |
| `reverse_complement` | Get reverse complement of DNA |
| `transcribe_dna` | Transcribe DNA to RNA |
| `calculate_gc_content` | Calculate GC percentage |
| `find_motif` | Find sequence motifs |
### Alignment
| Tool | Description |
|------|-------------|
| `pairwise_align` | Align two sequences |
| `multiple_sequence_alignment` | Align multiple sequences |
| `calculate_alignment_score` | Score alignments |
### Database Access
| Tool | Description |
|------|-------------|
| `fetch_genbank` | Retrieve GenBank records |
| `fetch_uniprot` | Retrieve UniProt entries |
| `search_pubmed` | Search PubMed literature |
| `fetch_sequence_by_id` | Get sequences by ID |
### Structure Analysis
| Tool | Description |
|------|-------------|
| `fetch_pdb_structure` | Download PDB structures |
| `calculate_structure_stats` | Analyze structure statistics |
| `find_active_site` | Extract active site info |
### Phylogenetics
| Tool | Description |
|------|-------------|
| `build_phylogenetic_tree` | Build phylogenetic trees |
| `calculate_distance_matrix` | Compute distance matrices |
| `draw_tree` | Visualize trees |
See the [Tools Reference](docs/tools-reference.md) for detailed documentation.
## Configuration Options
### Environment Variables
- `NCBI_EMAIL`: Email address for NCBI Entrez queries (recommended)
- `NCBI_API_KEY`: API key for higher NCBI rate limits (optional)
- `OBSIDIAN_VAULT_PATH`: Path to your Obsidian vault root directory (optional, for pubmed_review)
- When set, the LLM will determine the directory path and filename for saving literature reviews
- Can be overridden per-call with the `obsidian_vault` parameter
### Setting Environment Variables
```bash
export NCBI_EMAIL="your.email@example.com"
export NCBI_API_KEY="your_api_key_here"
export OBSIDIAN_VAULT_PATH="/Users/yourname/Documents/ObsidianVault"
```
## Examples
### Analyze a Gene Sequence
```python
# 1. Fetch from GenBank
fetch_genbank(accession="NM_000207", email="user@example.com")
# 2. Calculate GC content
calculate_gc_content(sequence="ATGGCC...")
# 3. Translate to protein
translate_sequence(sequence="ATGGCC...")
# 4. Find start codons
find_motif(sequence="ATGGCC...", motif="ATG")
```
### Compare Sequences
```python
# Perform global alignment
pairwise_align(
seq1="ATGGCCATTGTAATGGGCCGC",
seq2="ATGGCCATTGTTATGGGCCGC",
mode="global"
)
```
### Build Phylogenetic Tree
```python
# Build tree from aligned sequences
build_phylogenetic_tree(
sequences=["ATGGCC...", "ATGGCT...", "ATGGCA..."],
method="nj",
labels=["Species_A", "Species_B", "Species_C"]
)
```
See [examples/](examples/) for complete workflow examples.
## Documentation
- [Getting Started Guide](docs/getting-started.md)
- [Tools Reference](docs/tools-reference.md)
- [Usage Examples](docs/examples.md)
- [API Documentation](docs/)
## Contributing
We welcome contributions! Please see [CONTRIBUTING.md](CONTRIBUTING.md) for guidelines.
### Development Setup
1. Fork the repository
2. Clone your fork: `git clone https://github.com/yourusername/biopython-mcp.git`
3. Install development dependencies: `pip install -e ".[dev]"`
4. Install pre-commit hooks: `pre-commit install`
5. Create a feature branch: `git checkout -b feature-name`
6. Make your changes and commit
7. Run tests: `pytest`
8. Push and create a pull request
### Code Quality
We use:
- **Black** for code formatting
- **Ruff** for linting
- **mypy** for type checking
- **pytest** for testing
- **pre-commit** for automated checks
## Testing
Run tests:
```bash
pytest
```
Run tests with coverage:
```bash
pytest --cov=biopython_mcp --cov-report=term-missing
```
Generate coverage reports (HTML and XML):
```bash
pytest --cov=biopython_mcp --cov-report=html --cov-report=xml --cov-report=term-missing
```
View HTML coverage report:
```bash
open htmlcov/index.html # macOS
xdg-open htmlcov/index.html # Linux
start htmlcov/index.html # Windows
```
Run type checking:
```bash
mypy biopython_mcp/
```
### CI/CD Coverage
The project uses GitHub Actions for continuous integration with automatic coverage reporting to [Codecov](https://codecov.io/gh/kmaneesh/biopython-mcp).
Coverage is automatically uploaded when:
- Tests run on Ubuntu with Python 3.11
- Pull requests are created or updated
- Commits are pushed to `main` or `develop` branches
**Note for Contributors**: Coverage reports are publicly available. The CI workflow uses the `CODECOV_TOKEN` secret for authenticated uploads. Repository maintainers should configure this secret in GitHub repository settings.
## License
This project is licensed under the MIT License - see the [LICENSE](LICENSE) file for details.
## Citation
If you use BioPython MCP in your research, please cite:
```bibtex
@software{biopython_mcp,
title = {BioPython MCP: Model Context Protocol Server for BioPython},
author = {BioPython MCP Contributors},
year = {2026},
url = {https://github.com/kmaneesh/biopython-mcp}
}
```
## Acknowledgments
- Built on the excellent [BioPython](https://biopython.org/) library
- Uses [FastMCP](https://github.com/jlowin/fastmcp) for MCP implementation
- Inspired by the [Model Context Protocol](https://modelcontextprotocol.io/)
## Support
- **Issues**: [GitHub Issues](https://github.com/kmaneesh/biopython-mcp/issues)
- **Discussions**: [GitHub Discussions](https://github.com/kmaneesh/biopython-mcp/discussions)
- **Email**: [Contact maintainers](mailto:maintainers@example.com)
## Roadmap
- [ ] Add support for protein secondary structure prediction
- [ ] Implement BLAST search integration
- [ ] Add sequence feature annotation tools
- [ ] Support for custom HMM profiles
- [ ] Interactive structure visualization
- [ ] Batch processing capabilities
- [ ] REST API wrapper
## Related Projects
- [BioPython](https://biopython.org/) - The core library
- [Model Context Protocol](https://modelcontextprotocol.io/) - The MCP specification
- [FastMCP](https://github.com/jlowin/fastmcp) - MCP framework for Python
---
**Made with BioPython and MCP**
TDQS
Scored across 32 tools
There is some overlap between tools, particularly with multiple PubMed search functions (search_pubmed and pubmed_search) and the generic entrez_search also able to search PubMed. Other tools are largely distinct, but the redundancy creates potential confusion for an agent selecting the appropriate tool.
Most tools follow a verb_noun pattern (e.g., calculate_gc_content, fetch_uniprot), but a few deviate like reverse_complement (verb_object) and clinvar_variant_lookup (object_action). Overall naming is clear and mostly consistent.
With 32 tools covering multiple subdomains (sequence analysis, alignment, phylogenetics, NCBI, structure, literature), the tool count is high for a single MCP server. This breadth suggests the server could be split into more focused servers for better manageability and clarity.
The toolset covers a wide range of bioinformatics tasks, but there are notable gaps such as missing tools for sequence format conversion, codon usage analysis, or comprehensive structural analysis. Additionally, the multiple_sequence_alignment tool is noted as a placeholder, indicating incomplete implementation.