BioPython MCP Server
Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@BioPython MCP Servertranslate this DNA sequence ATGGCCATTGTAATGGGCCGC to protein"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
BioPython MCP Server
A Model Context Protocol (MCP) server that provides comprehensive BioPython capabilities for biological sequence analysis, alignment, database access, and structural bioinformatics.
Overview
BioPython MCP bridges the powerful BioPython library with MCP-enabled applications like Claude Desktop, allowing seamless integration of bioinformatics tools into AI-assisted workflows. This enables researchers, clinicians, and developers to perform complex biological analyses through natural language interfaces.
Motivation
Bioinformatics workflows often require switching between multiple tools and writing custom scripts. BioPython MCP simplifies this by:
Unified Interface: Access BioPython's capabilities through a standardized MCP protocol
AI Integration: Combine computational biology with AI-powered analysis and interpretation
Workflow Automation: Chain complex bioinformatics tasks through conversational interfaces
Accessibility: Make advanced bioinformatics tools available to non-programmers
Features
Sequence Operations
DNA/RNA translation and transcription
Reverse complement calculation
GC content analysis
Motif finding and pattern matching
Sequence Alignment
Pairwise global and local alignment
Multiple sequence alignment support
Alignment scoring with substitution matrices
Database Access
GenBank sequence retrieval
UniProt protein data access
PubMed literature search
NCBI database queries
Protein Structure Analysis
PDB structure fetching and parsing
Structure statistics calculation
Active site residue analysis
Phylogenetics
Phylogenetic tree construction (NJ, UPGMA)
Distance matrix calculation
Tree visualization
Installation
Requirements
Python 3.10 or higher
pip or uv package manager
Quick Install with uvx (Recommended)
The fastest way to run BioPython MCP without installation:
uvx biopython-mcpOr run from source:
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uvx --from . biopython-mcpInstall from PyPI
pip install biopython-mcpInstall from Source with uv
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate # On Windows: .venv\Scripts\activate
uv pip install -e ".[dev]"Install from Source with pip
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
pip install -e ".[dev]"Development Installation
For contributing or development:
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate
uv pip install -e ".[dev]"
pre-commit installQuick Start
Running the Server
Start the MCP server:
# With uvx (no installation needed)
uvx biopython-mcp
# Or if installed
biopython-mcpConfiguration for Claude Desktop
Add to your Claude Desktop configuration file:
macOS: ~/Library/Application Support/Claude/claude_desktop_config.json
Windows: %APPDATA%\Claude\claude_desktop_config.json
Using uvx (recommended):
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}Using installed package:
{
"mcpServers": {
"biopython": {
"command": "biopython-mcp",
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}Using local development version:
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["--from", "/path/to/biopython-mcp", "biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}Basic Usage Example
Once configured, you can use BioPython tools through Claude Desktop:
User: Translate the DNA sequence ATGGCCATTGTAATGGGCCGC to protein
Claude: [Uses translate_sequence tool]
Result: MAIVMGR (7 amino acids)
User: What's the GC content of this sequence?
Claude: [Uses calculate_gc_content tool]
Result: 57.14% GC contentAvailable Tools
Sequence Operations
Tool | Description |
| Translate DNA/RNA to protein |
| Get reverse complement of DNA |
| Transcribe DNA to RNA |
| Calculate GC percentage |
| Find sequence motifs |
Alignment
Tool | Description |
| Align two sequences |
| Align multiple sequences |
| Score alignments |
Database Access
Tool | Description |
| Retrieve GenBank records |
| Retrieve UniProt entries |
| Search PubMed literature |
| Get sequences by ID |
Structure Analysis
Tool | Description |
| Download PDB structures |
| Analyze structure statistics |
| Extract active site info |
Phylogenetics
Tool | Description |
| Build phylogenetic trees |
| Compute distance matrices |
| Visualize trees |
See the Tools Reference for detailed documentation.
Configuration Options
Environment Variables
NCBI_EMAIL: Email address for NCBI Entrez queries (recommended)NCBI_API_KEY: API key for higher NCBI rate limits (optional)OBSIDIAN_VAULT_PATH: Path to your Obsidian vault root directory (optional, for pubmed_review)When set, the LLM will determine the directory path and filename for saving literature reviews
Can be overridden per-call with the
obsidian_vaultparameter
Setting Environment Variables
export NCBI_EMAIL="your.email@example.com"
export NCBI_API_KEY="your_api_key_here"
export OBSIDIAN_VAULT_PATH="/Users/yourname/Documents/ObsidianVault"Examples
Analyze a Gene Sequence
# 1. Fetch from GenBank
fetch_genbank(accession="NM_000207", email="user@example.com")
# 2. Calculate GC content
calculate_gc_content(sequence="ATGGCC...")
# 3. Translate to protein
translate_sequence(sequence="ATGGCC...")
# 4. Find start codons
find_motif(sequence="ATGGCC...", motif="ATG")Compare Sequences
# Perform global alignment
pairwise_align(
seq1="ATGGCCATTGTAATGGGCCGC",
seq2="ATGGCCATTGTTATGGGCCGC",
mode="global"
)Build Phylogenetic Tree
# Build tree from aligned sequences
build_phylogenetic_tree(
sequences=["ATGGCC...", "ATGGCT...", "ATGGCA..."],
method="nj",
labels=["Species_A", "Species_B", "Species_C"]
)See examples/ for complete workflow examples.
Documentation
Contributing
We welcome contributions! Please see CONTRIBUTING.md for guidelines.
Development Setup
Fork the repository
Clone your fork:
git clone https://github.com/yourusername/biopython-mcp.gitInstall development dependencies:
pip install -e ".[dev]"Install pre-commit hooks:
pre-commit installCreate a feature branch:
git checkout -b feature-nameMake your changes and commit
Run tests:
pytestPush and create a pull request
Code Quality
We use:
Black for code formatting
Ruff for linting
mypy for type checking
pytest for testing
pre-commit for automated checks
Testing
Run tests:
pytestRun tests with coverage:
pytest --cov=biopython_mcp --cov-report=term-missingGenerate coverage reports (HTML and XML):
pytest --cov=biopython_mcp --cov-report=html --cov-report=xml --cov-report=term-missingView HTML coverage report:
open htmlcov/index.html # macOS
xdg-open htmlcov/index.html # Linux
start htmlcov/index.html # WindowsRun type checking:
mypy biopython_mcp/CI/CD Coverage
The project uses GitHub Actions for continuous integration with automatic coverage reporting to Codecov.
Coverage is automatically uploaded when:
Tests run on Ubuntu with Python 3.11
Pull requests are created or updated
Commits are pushed to
mainordevelopbranches
Note for Contributors: Coverage reports are publicly available. The CI workflow uses the CODECOV_TOKEN secret for authenticated uploads. Repository maintainers should configure this secret in GitHub repository settings.
License
This project is licensed under the MIT License - see the LICENSE file for details.
Citation
If you use BioPython MCP in your research, please cite:
@software{biopython_mcp,
title = {BioPython MCP: Model Context Protocol Server for BioPython},
author = {BioPython MCP Contributors},
year = {2026},
url = {https://github.com/kmaneesh/biopython-mcp}
}Acknowledgments
Built on the excellent BioPython library
Uses FastMCP for MCP implementation
Inspired by the Model Context Protocol
Support
Issues: GitHub Issues
Discussions: GitHub Discussions
Email: Contact maintainers
Roadmap
Add support for protein secondary structure prediction
Implement BLAST search integration
Add sequence feature annotation tools
Support for custom HMM profiles
Interactive structure visualization
Batch processing capabilities
REST API wrapper
Related Projects
BioPython - The core library
Model Context Protocol - The MCP specification
FastMCP - MCP framework for Python
Made with BioPython and MCP
Resources
Unclaimed servers have limited discoverability.
Looking for Admin?
If you are the server author, to access and configure the admin panel.
Latest Blog Posts
MCP directory API
We provide all the information about MCP servers via our MCP API.
curl -X GET 'https://glama.ai/api/mcp/v1/servers/kmaneesh/biopython-mcp'
If you have feedback or need assistance with the MCP directory API, please join our Discord server