MCP Sequence Simulation Server
# MCP Sequence Simulation Server
An MCP (Model Context Protocol) server for simulating DNA and amino acid sequences using various evolutionary models and algorithms. This server provides powerful tools for sequence generation, mutation simulation, evolutionary modeling, and phylogenetic analysis.
## Features
### 🧬 DNA Sequence Generation
- **Random DNA Generation**: Generate sequences with specified GC content
- **Markov Chain Models**: Context-dependent sequence generation
- **Codon-Biased Generation**: Realistic protein-coding sequences
- **Customizable Parameters**: Length, GC content, seed for reproducibility
### 📊 FASTQ Sequencing Simulation
- **NGS Read Simulation**: Generate realistic next-generation sequencing reads
- **Platform-Specific Models**: Illumina, 454, Ion Torrent, and PacBio quality models
- **Paired-End Support**: Both single-end and paired-end sequencing reads
- **Error Modeling**: Configurable sequencing error rates with realistic quality scores
- **Coverage Control**: Generate reads to achieve specified coverage depths
- **NEAT-Based**: Implementation inspired by published NEAT methodology
### 🧠Protein Sequence Generation
- **Random Protein Generation**: Uniform amino acid distribution
- **Hydrophobic-Biased**: Membrane protein-like sequences
- **Disorder-Prone**: Intrinsically disordered protein sequences
- **Custom Composition**: User-defined amino acid frequencies
### 🔬 Sequence Mutation
- **Substitution Mutations**: Point mutations with transition/transversion bias
- **Insertion/Deletion Events**: Indel mutations
- **Multiple Iterations**: Track changes over time
- **Both DNA and Protein**: Support for nucleotide and amino acid sequences
### 🌳 Evolutionary Simulation
- **Population Evolution**: Simulate populations over generations
- **Selection Pressure**: Configurable fitness functions
- **Lineage Tracking**: Follow individual evolutionary paths
- **Fitness Functions**: GC content, length, hydrophobicity targets
### 🌲 Phylogenetic Simulation
- **Tree-Based Evolution**: Simulate sequences on phylogenetic trees
- **Multiple Substitution Models**: JC69, K80, HKY85, GTR
- **Molecular Clock**: Uniform or variable evolutionary rates
- **Multiple Output Formats**: FASTA, NEXUS, PHYLIP
## Installation
```bash
npm install
npm run build
```
## Usage
### With Claude Code
```bash
./start-claude.sh
```
### Manual Configuration
Add to your Claude Code MCP configuration:
```json
{
"mcpServers": {
"sequence-simulation": {
"command": "node",
"args": ["dist/server.js"],
"cwd": "/path/to/mcp-sequence-simulation"
}
}
}
```
## Available Tools
### 1. Generate DNA Sequence
Generate random DNA sequences with various models.
**Parameters:**
- `length` (required): Sequence length
- `gcContent` (optional): GC content ratio (0-1, default: 0.5)
- `count` (optional): Number of sequences (default: 1)
- `model` (optional): "random", "markov", or "codon-biased"
- `seed` (optional): Random seed for reproducibility
- `outputFormat` (optional): "fasta" or "plain"
**Example:**
```json
{
"length": 1000,
"gcContent": 0.6,
"count": 5,
"model": "markov",
"outputFormat": "fasta"
}
```
### 2. Generate Protein Sequence
Generate random protein sequences with various biases.
**Parameters:**
- `length` (required): Sequence length
- `count` (optional): Number of sequences (default: 1)
- `model` (optional): "random", "hydrophobic-bias", or "disorder-prone"
- `composition` (optional): Custom amino acid frequencies
- `seed` (optional): Random seed
- `outputFormat` (optional): "fasta" or "plain"
**Example:**
```json
{
"length": 200,
"count": 3,
"model": "hydrophobic-bias",
"outputFormat": "fasta"
}
```
### 3. Simulate FASTQ File
Simulate FASTQ sequencing reads with realistic quality scores and error models.
**Parameters:**
- `referenceSequence` (required): Reference DNA sequence to generate reads from
- `readLength` (required): Length of each sequencing read (50-300 bp)
- `coverage` (required): Target sequencing coverage depth (1-1000x)
- `readType` (optional): "single-end" or "paired-end" (default: "single-end")
- `insertSize` (optional): Mean insert size for paired-end reads (default: 300)
- `insertSizeStd` (optional): Standard deviation of insert size (default: 50)
- `errorRate` (optional): Base calling error rate 0-0.1 (default: 0.01)
- `qualityModel` (optional): "illumina", "454", "ion-torrent", or "pacbio" (default: "illumina")
- `mutationRate` (optional): Rate of true mutations 0-0.05 (default: 0.001)
- `seed` (optional): Random seed for reproducibility
- `outputFormat` (optional): "fastq" or "json" (default: "fastq")
**Example:**
```json
{
"referenceSequence": "ATCGATCGATCGATCGATCGATCGATCGATCGATCG",
"readLength": 150,
"coverage": 30,
"readType": "paired-end",
"errorRate": 0.01,
"qualityModel": "illumina"
}
```
**Citation:** Based on Stephens et al. (2016) PLOS ONE 11(11): e0167047.
### 4. Mutate Sequence
Apply mutations to existing sequences.
**Parameters:**
- `sequence` (required): Input sequence
- `sequenceType` (required): "dna" or "protein"
- `substitutionRate` (optional): Substitution rate (default: 0.01)
- `insertionRate` (optional): Insertion rate (default: 0.001)
- `deletionRate` (optional): Deletion rate (default: 0.001)
- `transitionBias` (optional): Transition vs transversion bias for DNA (default: 2.0)
- `iterations` (optional): Number of mutation rounds (default: 1)
- `seed` (optional): Random seed
- `outputFormat` (optional): "fasta" or "plain"
**Example:**
```json
{
"sequence": "ATGCGATCGATCG",
"sequenceType": "dna",
"substitutionRate": 0.02,
"iterations": 5,
"outputFormat": "fasta"
}
```
### 5. Evolve Sequence
Simulate sequence evolution over multiple generations.
**Parameters:**
- `sequence` (required): Starting sequence
- `generations` (required): Number of generations
- `populationSize` (required): Population size
- `mutationRate` (required): Mutation rate per generation
- `selectionPressure` (optional): Selection strength (0-1)
- `fitnessFunction` (optional): "gc-content", "length", "hydrophobic", or "custom"
- `targetValue` (optional): Target value for fitness function
- `trackLineages` (optional): Track individual lineages
- `seed` (optional): Random seed
- `outputFormat` (optional): "summary", "detailed", or "fasta"
**Example:**
```json
{
"sequence": "ATGCGATCGATCG",
"generations": 100,
"populationSize": 50,
"mutationRate": 0.01,
"selectionPressure": 0.3,
"fitnessFunction": "gc-content",
"targetValue": 0.5,
"outputFormat": "detailed"
}
```
### 6. Simulate Phylogeny
Simulate sequence evolution on phylogenetic trees.
**Parameters:**
- `rootSequence` (required): Ancestral sequence
- `treeStructure` (optional): Newick format tree or "random"
- `numTaxa` (optional): Number of taxa for random tree (default: 5)
- `mutationRate` (optional): Mutation rate per branch length (default: 0.1)
- `branchLengthVariation` (optional): Branch length variation (default: 0.2)
- `molecularClock` (optional): Use molecular clock (default: true)
- `substitutionModel` (optional): "JC69", "K80", "HKY85", or "GTR"
- `seed` (optional): Random seed
- `outputFormat` (optional): "fasta", "nexus", or "phylip"
**Example:**
```json
{
"rootSequence": "ATGCGATCGATCGATCG",
"numTaxa": 8,
"mutationRate": 0.05,
"substitutionModel": "K80",
"outputFormat": "nexus"
}
```
## Output Formats
### FASTA Format
Standard FASTA format with descriptive headers containing simulation parameters.
### Statistics
All tools provide detailed statistics including:
- Sequence composition analysis
- Mutation counts and types
- Evolutionary parameters
- Phylogenetic tree statistics
### Specialized Formats
- **NEXUS**: For phylogenetic analysis software
- **PHYLIP**: For phylogenetic analysis
- **JSON**: Structured data with full simulation details
## Use Cases
### Research Applications
- **Molecular Evolution Studies**: Simulate sequence evolution under different models
- **Phylogenetic Analysis**: Generate test datasets with known evolutionary history
- **Algorithm Testing**: Create benchmark datasets for bioinformatics tools
- **Educational Purposes**: Demonstrate evolutionary principles
### Bioinformatics Development
- **Algorithm Validation**: Test sequence analysis tools with controlled data
- **Statistical Analysis**: Generate null distributions for statistical tests
- **Performance Benchmarking**: Create datasets of varying complexity
- **Method Comparison**: Compare tools on simulated vs real data
## Technical Details
### Evolutionary Models
- **Jukes-Cantor (JC69)**: Equal substitution rates
- **Kimura 2-Parameter (K80)**: Transition/transversion bias
- **HKY85**: Unequal base frequencies with transition bias
- **GTR**: General time-reversible model
### Sequence Generation
- **Markov Chains**: Context-dependent nucleotide selection
- **Codon Usage Bias**: Realistic protein-coding sequences
- **Amino Acid Properties**: Hydrophobicity and disorder propensity
### Mutation Models
- **Point Mutations**: Single nucleotide/amino acid changes
- **Indels**: Insertion and deletion events
- **Transition Bias**: Realistic DNA mutation patterns
## Dependencies
- **@modelcontextprotocol/sdk**: MCP framework
- **zod**: Schema validation
- **typescript**: Type safety
- **Node.js**: Runtime environment
## Contributing
This server provides a comprehensive framework for sequence simulation. Extensions could include:
- Additional substitution models
- Recombination simulation
- Population genetics models
- Structural constraints
- Codon usage tables for different organisms
## License
See LICENSE file for details.
TDQS
Scored across 6 tools
Each tool has a clearly distinct purpose with no ambiguity. Tools target specific simulation tasks: sequence generation (DNA/protein), evolution (evolve/mutate), phylogeny simulation, and FASTQ file generation. The descriptions clearly differentiate their scopes, preventing misselection.
All tools follow a consistent verb_noun pattern (e.g., evolve_sequence, generate_dna_sequence, simulate_fastq_file). The naming convention is uniform throughout, using snake_case and clear action-object pairs, making the tool set predictable and readable.
With 6 tools, the count is well-scoped for a sequence simulation server. Each tool earns its place by covering key aspects: sequence generation, mutation, evolution, phylogeny, and FASTQ simulation. This provides a focused yet comprehensive surface without being overwhelming.
The tool set covers core sequence simulation workflows effectively, including generation, mutation, evolution, phylogeny, and sequencing data. A minor gap is the lack of tools for analyzing or visualizing simulated data, but agents can work around this as the surface supports essential simulation tasks.