bio-mcp-evo2
OfficialIntegrates with NVIDIA NIM (Inference Microservices) to provide cloud-based access to the evo2 genomic foundation model for DNA sequence generation, scoring, embedding, and variant effect prediction.
Click on "Install Server".
Wait a few minutes for the server to deploy. Once ready, it will show a "Started" state.
In the chat, type
@followed by the MCP server name and your instructions, e.g., "@bio-mcp-evo2Generate a 100bp DNA sequence that could function as a promoter"
That's it! The server will respond to your query, and you can continue using it as needed.
Here is a step-by-step guide with screenshots.
bio-mcp-evo2
MCP server for evo2 DNA language model - enabling AI assistants to generate and analyze DNA sequences using state-of-the-art genomic foundation models.
Overview
evo2 is a genomic foundation model capable of:
Generating DNA sequences with specified properties
Scoring sequence likelihoods and calculating perplexity
Extracting learned representations for downstream tasks
Predicting variant effects on biological function
This MCP server provides multiple execution modes to support various computational environments:
Local: Direct GPU execution (requires H100 or compatible GPU)
SBATCH: Submit jobs to SLURM clusters
Singularity/Docker: Container-based execution
API: Nvidia NIM cloud API (no local GPU required)
Related MCP server: SCMCP
Installation
Local Installation
git clone https://github.com/bio-mcp/bio-mcp-evo2.git
cd bio-mcp-evo2
pip install -e .[dev]Container Installation
Docker
docker build -t bio-mcp-evo2 .
docker run --gpus all bio-mcp-evo2Singularity (HPC)
singularity build --fakeroot evo2.sif Singularity.def
singularity run --nv evo2.sifConfiguration
Environment Variables
# Execution mode selection
export BIO_MCP_EVO2_EXECUTION_MODE=api # Options: local, sbatch, singularity, docker, api
# Model configuration
export BIO_MCP_EVO2_MODEL_SIZE=7b # Options: 7b, 40b
export BIO_MCP_EVO2_CUDA_DEVICE=0
# API configuration (for API mode)
export BIO_MCP_EVO2_NIM_API_KEY=your-api-key
# SBATCH configuration (for HPC clusters)
export BIO_MCP_EVO2_SBATCH_PARTITION=gpu
export BIO_MCP_EVO2_SBATCH_TIME=01:00:00
export BIO_MCP_EVO2_SBATCH_MEMORY=64G
export BIO_MCP_EVO2_SBATCH_GPU_TYPE=h100Claude Desktop Integration
Add to your claude_desktop_config.json:
{
"mcpServers": {
"bio-evo2": {
"command": "python",
"args": ["-m", "src.server"],
"cwd": "/path/to/bio-mcp-evo2",
"env": {
"BIO_MCP_EVO2_EXECUTION_MODE": "api",
"BIO_MCP_EVO2_NIM_API_KEY": "your-api-key"
}
}
}
}For HPC with Singularity:
{
"mcpServers": {
"bio-evo2": {
"command": "singularity",
"args": ["run", "--nv", "/path/to/evo2.sif"],
"env": {
"BIO_MCP_EVO2_EXECUTION_MODE": "local"
}
}
}
}Available Tools
evo2_generate
Generate DNA sequences from a prompt.
# Example usage
result = await evo2_generate({
"prompt": "ATCGATCGATCG",
"n_tokens": 100,
"temperature": 1.0,
"top_k": 4
})evo2_score
Calculate sequence perplexity or get raw logits.
# Example usage
result = await evo2_score({
"sequence": "ATCGATCGATCGATCGATCG",
"return_logits": False
})evo2_embed
Extract learned representations from sequences.
# Example usage
result = await evo2_embed({
"sequence": "ATCGATCGATCGATCGATCG",
"layer": "blocks.28.mlp.l3"
})evo2_variant_effect
Predict the effect of mutations.
# Example usage
result = await evo2_variant_effect({
"reference_sequence": "ATCGATCGATCGATCGATCG",
"variant_sequence": "ATCGATCGATCGATCAATCG",
"context_window": 1000
})Execution Modes
API Mode (Recommended for Getting Started)
No GPU required. Uses Nvidia's hosted API.
export BIO_MCP_EVO2_EXECUTION_MODE=api
export BIO_MCP_EVO2_NIM_API_KEY=your-key
python -m src.serverLocal Mode
Requires H100 GPU with sufficient memory.
export BIO_MCP_EVO2_EXECUTION_MODE=local
python -m src.serverSBATCH Mode
For HPC clusters with SLURM.
export BIO_MCP_EVO2_EXECUTION_MODE=sbatch
export BIO_MCP_EVO2_SBATCH_PARTITION=gpu
python -m src.serverContainer Modes
For isolated execution environments.
# Docker
export BIO_MCP_EVO2_EXECUTION_MODE=docker
docker run --gpus all -v $PWD:/workspace bio-mcp-evo2
# Singularity
export BIO_MCP_EVO2_EXECUTION_MODE=singularity
singularity run --nv evo2.sifExamples
Generate a promoter sequence
User: Generate a 200bp DNA sequence that could function as a promoterThis server cannot be installed
Maintenance
Resources
Unclaimed servers have limited discoverability.
Looking for Admin?
If you are the server author, to access and configure the admin panel.
Related MCP Servers
- AlicenseAqualityCmaintenanceEnables genomic sequence analysis through the Evo 2 model, supporting DNA sequence scoring, embedding, generation, and variant effect prediction with multiple model checkpoints (7B, 40B, 1B parameters).62LGPL 3.0
- Alicense-qualityCmaintenanceAn MCP server that enables scRNA-Seq analysis through natural language, providing tools for data preprocessing, clustering, and biological visualization. It supports both predefined function execution and a flexible code mode powered by a Jupyter backend for automated single-cell transcriptomics workflows.15BSD 3-Clause
- Alicense-qualityFmaintenanceAn MCP server for the gget bioinformatics library that enables AI assistants to perform complex genomics queries, including gene sequence retrieval, BLAST alignments, and protein structure predictions.30MIT
- Alicense-qualityCmaintenanceAn MCP server that gives LLM agents access to computational protein design tools.15Apache 2.0
Related MCP Connectors
MCP server for AI dialogue using various LLM models via AceDataCloud
MCP server for MiniMax H3 multimodal video generation
MCP server for Wan AI video generation
Latest Blog Posts
- Who's Calling? MCP Hosts Are an Identity Blind Spot (And the Spec Knows It)By Om-Shree-0709 on .mcpAgent IdentityOAuth 2.1
- Your AI Chatbot Just Exposed Your CEO's Salary to an InternBy Om-Shree-0709 on .Agent IdentityMCP SecurityOAuth Delegation
- Why MCP Servers Need Execution Sandboxing (And Why Your Current Stack Isn't Enough)By Om-Shree-0709 on .Agentic AiPrompt InjectionWebAssembly
MCP directory API
We provide all the information about MCP servers via our MCP API.
curl -X GET 'https://glama.ai/api/mcp/v1/servers/bio-mcp/bio-mcp-evo2'
If you have feedback or need assistance with the MCP directory API, please join our Discord server