# Getting Started with BioPython MCP
This guide will help you get started with the BioPython MCP server.
## Installation
### Prerequisites
- Python 3.10 or higher
- pip package manager
### Install from PyPI
```bash
pip install biopython-mcp
```
### Install from Source
```bash
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
pip install -e ".[dev]"
```
## Running the Server
Start the MCP server:
```bash
biopython-mcp
```
The server will start and listen for MCP protocol connections.
## Configuration
### Setting Your Email for NCBI
NCBI requires an email address for API access. You can set this as an environment variable:
```bash
export NCBI_EMAIL="your.email@example.com"
```
Or pass it as a parameter when calling database tools.
### MCP Client Configuration
Configure your MCP client (e.g., Claude Desktop) to connect to the BioPython MCP server:
```json
{
"mcpServers": {
"biopython": {
"command": "biopython-mcp"
}
}
}
```
## Quick Example
Once connected, you can use the tools through your MCP client:
```
# Translate a DNA sequence
Tool: translate_sequence
Input: {"sequence": "ATGGCCATTGTAATGGGCCGC"}
# Calculate GC content
Tool: calculate_gc_content
Input: {"sequence": "ATGGCCATTGTAATGGGCCGC"}
# Fetch a GenBank record
Tool: fetch_genbank
Input: {"accession": "NM_000207", "email": "your@email.com"}
```
## Available Tool Categories
- **Sequence Operations**: Translation, transcription, reverse complement, GC content, motif finding
- **Alignment**: Pairwise alignment, multiple sequence alignment, scoring
- **Database Access**: GenBank, UniProt, PubMed searches
- **Structure Analysis**: PDB structure fetching and analysis
- **Phylogenetics**: Tree building, distance matrices, visualization
## Next Steps
- Read the [Tools Reference](tools-reference.md) for detailed information on each tool
- Check out the [Examples](examples.md) for common workflows
- See the main [README](../README.md) for contributing guidelines
## Troubleshooting
### Import Errors
If you encounter import errors, ensure all dependencies are installed:
```bash
pip install -r requirements.txt
```
### NCBI Connection Issues
NCBI may rate-limit requests. Ensure you:
- Provide a valid email address
- Don't make too many requests in quick succession
- Consider using NCBI API keys for higher rate limits
### Type Checking Errors
Run mypy to check for type issues:
```bash
mypy biopython_mcp/
```
