jean — Molecular Biology & Genomics

export_barcodes

Read-only

Write an index set out in the form the next step needs: a CSV or TSV order sheet, FASTA, an IDT bulk-input sheet of the bare tags, an Illumina BCLConvert SampleSheet, or the actual oligos — adapters built on a template, or primers carrying the tag — with the junction warnings that emission produces.

Input Schema

TableJSON Schema

Name	Required	Description	Default
`_files`	No	The project: record references shaped like _subject. Their records become library documents a tool names in sequences/parts/document; a trace or alignment is found by file name.
`format`	No	what to write. Values: csv (CSV order sheet), tsv (TSV), fasta (FASTA), idt (IDT bulk input), samplesheet (Illumina SampleSheet), adapters (Adapter oligos), primers (Tagged primers).	csv
`prefix`	No	name prefix for the rows (BC001, BC002 …).	BC
`primer`	No	the primer the tag is added to. Only applies when format is primers.
`_subject`	No	The record to act on: exactly one of sequence, accession (+source), sample (an id from list_samples) or file ({name, text} or {name, base64}); record_index picks one record of several.
`barcodes`	Yes	the index sequences to write out.
`adapter_3`	No	sequence 3' of the tag in the adapter — the TruSeq read-1 primer, as the panel offers. Only applies when format is adapters.	ACACTCTTTCCCTACACGACGCTCTTCCGATCT
`adapter_5`	No	sequence 5' of the tag in the adapter — the Illumina P5, as the panel offers. Only applies when format is adapters.	AATGATACGGCGACCACCGAGATCTACAC
`idt_scale`	No	IDT synthesis scale, exactly as IDT writes it (e.g. 25nm, 100nm, 250nm). Asked for rather than defaulted: which options exist depends on oligo length. Only applies when format is idt.
`idt_purification`	No	IDT purification (e.g. STD, PAGE, HPLC). Check what your scale allows before ordering. Only applies when format is idt.

Output Schema

TableJSON Schema

Name	Required	Description
`text`	Yes	the written file, for the text formats
`count`	Yes	how many barcodes were written
`oligos`	Yes	the emitted oligos, for the adapter and primer formats — empty for the text formats
`warnings`	Yes	junction warnings the emission found — a tag that creates a homopolymer or a restriction site at its junction. Empty for the text formats, which build no junction

Schema Changelog

Changes observed during successful MCP inspections.

First observedOct 20, 2026

TDQS

A3.9/5.0

Behavior4/5

Does the description disclose side effects, auth requirements, rate limits, or destructive behavior?

Annotations already cover the safety profile (readOnlyHint=true, destructiveHint=false, openWorldHint=false), so the description is free to add context and does: it discloses that emission produces junction warnings and that adapter/oligo formats are built from templates carrying the tag. It does not clarify whether output is written to disk or returned in the response.

Agents need to know what a tool does to the world before calling it. Descriptions should go beyond structured annotations to explain consequences.

Conciseness5/5

Is the description appropriately sized, front-loaded, and free of redundancy?

A single front-loaded sentence led by the verb and scope, with the format list nested cleanly. Dense but every clause (formats, oligo types, junction warnings) carries information, and nothing is padded.

Shorter descriptions cost fewer tokens and are easier for agents to parse. Every sentence should earn its place.

Completeness4/5

Given the tool's complexity, does the description cover enough for an agent to succeed on first attempt?

With an output schema present, return values need no explanation, and the rich schema plus annotations carry parameters and safety. The description covers purpose, formats and the warning behavior; the only real gap is the write-vs-return ambiguity for a tool named 'export'.

Complex tools with many parameters or behaviors need more documentation. Simple tools need less. This dimension scales expectations accordingly.

Parameters4/5

Does the description clarify parameter syntax, constraints, interactions, or defaults beyond what the schema provides?

Schema description coverage is 100%, so the baseline is 3, but the description adds real meaning: it distinguishes the adapter formats (oligos built on a template) from the primer format (tag carried on a primer), which explains the format/primer/adapter_* relationship better than the bare enum does.

Input schemas describe structure but not intent. Descriptions should explain non-obvious parameter relationships and valid value ranges.

Purpose4/5

Does the description clearly state what the tool does and how it differs from similar tools?

States a specific verb and resource ('Write an index set') and enumerates the exact output forms (CSV/TSV order sheet, FASTA, IDT bulk input, BCLConvert SampleSheet, adapters, primers). An agent can tell this is the export/emission step rather than a design step, though it never names sibling tools like design_barcodes or audit_barcodes.

Agents choose between tools based on descriptions. A clear purpose with a specific verb and resource helps agents select the right tool.

Usage Guidelines3/5

Does the description explain when to use this tool, when not to, or what alternatives exist?

'in the form the next step needs' implies this is a downstream emission step, and the format enumeration implies which consumer each output serves. But there is no explicit when-to-use/when-not guidance and no named alternative tool, so the routing signal is only implied.

Agents often have multiple tools that could apply. Explicit usage guidance like "use X instead of Y when Z" prevents misuse.

All jean — Molecular Biology & Genomics tools Inspect

Try in Browser

One endpoint for every MCP toolRayrun runs every MCP server behind one URL and holds the credentials. Each call is decided per client, tool, and argument, then recorded.ray.runAd

Glama MCP Gateway

Add one secure layer between your agents and this server.

Resources

Need Help?