jean — Molecular Biology & Genomics

assemble_index_oligos

Read-only

Turn index sequences into the oligos a synthesiser makes: each index spliced between 5'/3' adapter arms, or onto a PCR primer in either orientation with an optional spacer. Audited for the problems that only exist once tag and oligo are concatenated and that no check of the index alone can see — a homopolymer run across the junction, a 5' tetramer recurring as its reverse complement, and an oligo over the synthesis length guideline.

Input Schema

TableJSON Schema

Name	Required	Description	Default
`_files`	No	The project: record references shaped like _subject. Their records become library documents a tool names in sequences/parts/document; a trace or alignment is found by file name.
`format`	No	adapter arms around the index, or a tagged PCR primer. Values: adapter (5'/3' adapter arms), primer (Tagged PCR primer).	adapter
`primer`	No	the PCR primer the tag is appended to — required when `format` is `primer`.
`spacer`	No	bases between the tag and the primer. Heterogeneity/phasing spacers are routine on a low-diversity library. Advanced.
`_subject`	No	The record to act on: exactly one of sequence, accession (+source), sample (an id from list_samples) or file ({name, text} or {name, base64}); record_index picks one record of several.
`barcodes`	Yes	the index sequences to assemble.
`adapter_3`	No	3' arm the index is spliced before — the TruSeq read-1 primer, and the panel's own default.	ACACTCTTTCCCTACACGACGCTCTTCCGATCT
`adapter_5`	No	5' arm the index is spliced after — the Illumina P5, and the panel's own default.	AATGATACGGCGACCACCGAGATCTACAC
`reverse_complement_tag`	No	append the tag as its reverse complement, as the instrument requires for some read orientations. Advanced.

Output Schema

TableJSON Schema

Name	Required	Description
`count`	Yes	how many oligos were assembled
`oligos`	Yes	each assembled oligo with its name, sequence and length
`longest`	Yes	the longest assembled oligo, in bases — the number a synthesis quote turns on
`warnings`	Yes	junction problems that only exist once tag and oligo are joined: a run across the junction, a self-complementary 5' tetramer, an oligo over the synthesis guideline

Schema Changelog

Changes observed during successful MCP inspections.

First observedOct 20, 2026

TDQS

A4/5.0

Behavior4/5

Does the description disclose side effects, auth requirements, rate limits, or destructive behavior?

Annotations already declare readOnlyHint=true and destructiveHint=false. The description adds genuine behavioral context beyond them: it discloses the auditing performed on concatenated tag+oligo products (junction homopolymer, reverse-complement 5' tetramer, synthesis length).

Agents need to know what a tool does to the world before calling it. Descriptions should go beyond structured annotations to explain consequences.

Conciseness5/5

Is the description appropriately sized, front-loaded, and free of redundancy?

Two front-loaded sentences: the first states the conversion and output formats; the second states the audit scope. No filler, and the purpose precedes the caveats.

Shorter descriptions cost fewer tokens and are easier for agents to parse. Every sentence should earn its place.

Completeness4/5

Given the tool's complexity, does the description cover enough for an agent to succeed on first attempt?

Given an output schema, rich annotations, and 100% schema coverage, the description supplies the needed conceptual and audit context. It omits some minor operational details (e.g., that barcodes is required, or that primer is required with format=primer), but the schema handles those.

Complex tools with many parameters or behaviors need more documentation. Simple tools need less. This dimension scales expectations accordingly.

Parameters3/5

Does the description clarify parameter syntax, constraints, interactions, or defaults beyond what the schema provides?

Schema description coverage is 100%, so the baseline is 3. The description reinforces the adapter-vs-primer format, orientation, and optional spacer, but adds no syntax or constraints beyond the schema's own per-parameter descriptions.

Input schemas describe structure but not intent. Descriptions should explain non-obvious parameter relationships and valid value ranges.

Purpose5/5

Does the description clearly state what the tool does and how it differs from similar tools?

The description states a specific verb and resource ('Turn index sequences into the oligos a synthesiser makes') and distinguishes its scope from index-only checks by noting it audits problems visible only after tag and oligo are concatenated.

Agents choose between tools based on descriptions. A clear purpose with a specific verb and resource helps agents select the right tool.

Usage Guidelines3/5

Does the description explain when to use this tool, when not to, or what alternatives exist?

Usage is implied by the assembly purpose and the audit clause, but the description never explicitly says when to choose this over siblings like design_barcodes, audit_barcodes, or check_index_pool, nor does it state prerequisites or exclusions.

Agents often have multiple tools that could apply. Explicit usage guidance like "use X instead of Y when Z" prevents misuse.

All jean — Molecular Biology & Genomics tools Inspect

Try in Browser

One endpoint for every MCP toolRayrun runs every MCP server behind one URL and holds the credentials. Each call is decided per client, tool, and argument, then recorded.ray.runAd

Glama MCP Gateway

Add one secure layer between your agents and this server.

Resources

Need Help?