assemble_index_oligos
Read-only
Turn index sequences into the oligos a synthesiser makes: each index spliced between 5'/3' adapter arms, or onto a PCR primer in either orientation with an optional spacer.
Input Schema
| Name | Required | Description | Default |
|---|---|---|---|
| _files | No | The project: record references shaped like _subject. Their records become library documents a tool names in sequences/parts/document; a trace or alignment is found by file name. | |
| format | No | adapter arms around the index, or a tagged PCR primer. Values: adapter (5'/3' adapter arms), primer (Tagged PCR primer). | adapter |
| primer | No | the PCR primer the tag is appended to — required when `format` is `primer`. | |
| spacer | No | bases between the tag and the primer. Heterogeneity/phasing spacers are routine on a low-diversity library. Advanced. | |
| _subject | No | The record to act on: exactly one of sequence, accession (+source), sample (an id from list_samples) or file ({name, text} or {name, base64}); record_index picks one record of several. | |
| barcodes | Yes | the index sequences to assemble. | |
| adapter_3 | No | 3' arm the index is spliced before — the TruSeq read-1 primer, and the panel's own default. | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| adapter_5 | No | 5' arm the index is spliced after — the Illumina P5, and the panel's own default. | AATGATACGGCGACCACCGAGATCTACAC |
| reverse_complement_tag | No | use each tag as its reverse complement, in an adapter or on a primer, as the instrument requires for some read orientations. Advanced. |
Output Schema
| Name | Required | Description | Default |
|---|---|---|---|
| count | Yes | how many oligos were assembled | |
| oligos | Yes | each assembled oligo with its name, sequence and length | |
| longest | Yes | the longest assembled oligo, in bases — the number a synthesis quote turns on | |
| warnings | Yes | junction problems that only exist once tag and oligo are joined: a run across the junction, a self-complementary 5' tetramer, an oligo over the synthesis guideline |